Esta tienda utiliza cookies para asegurar que damos la mejor experiencia al usuario en nuestro sitio web. Si continúa utilizando este sitio asumiremos que está de acuerdo.

aceptar

COVID-19 Set1 Cebadores y sondas (Gen E)

180,00 €

COVID-19 Set1 - Cebadores y sondas Gen E, RT-PCR en tiempo real para el nuevo coronavirus 2019 (COVID-19)

Cantidad

 

Security policy (edit with Customer reassurance module)

 

Delivery policy (edit with Customer reassurance module)

 

Return policy (edit with Customer reassurance module)

First line screening assay Gen E

Cebadores y sondas (scala 0,04 µmol), RT-PCR en tiempo real para el nuevo coronavirus 2019 (COVID-19) - First line screening assay:

Name Sequence (5'-3') Scale Purification Physical Condition
E_Sarbeco_F ACA GGT ACG TTA ATA GTT AAT AGC GT 0.04 µmol HPLC Dried
E_Sarbeco_R ATA TTG CAG CAG TAC GCA CAC A 0.04 µmol HPLC Dried
E_Sarbeco_P1 [FAM (Fluorescein)]ACA CTA GCC ATC CTT ACT GCG CTT CG[BHQ-1] 0.04 µmol HPLC Dried

Estos cebadores y sondas son los recomendados por la OMS de acuerdo con el articulo: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/

 

 

Assay/use

Oligonucleotide

Sequencea

Concentrationb

E gene

E_Sarbeco_F

ACAGGTACGTTAATAGTTAATAGCGT

Use 400 nm per reaction

E_Sarbeco_P1

FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ

Use 200 nm per reaction

E_Sarbeco_R

ATATTGCAGCAGTACGCACACA

Use 400 nm per reaction

COVID-19_Set1

También podría interesarle